Project and resources to consult. My team predicted

Project III: GenotypesPCR: Lactose and PCTKevin LesniakJordan Turner, Nick Slavic, Connor Welch0A24 – LandsonWhen taking a step back and looking at all of the living creatures on earth, specifically the human race, anyone can make a general assumption and figure out that there’s a reason we are all so different from one another. It isn’t decided by some random chance that this boy was born with blonde hair or this girl with hazel eyes, rather it is decided by our genotypes. A genotype determines not only what someone will look like, but also the way their organs function, which is why some people get disorders or diseases while others stay disease-free their whole life. As defined by the Personal Genetics Education Project, a genotype is your complete heritable genetic identity, it’s what makes you, you. It can be used to not only target specific unique qualities that someone carries, but also their entire genetic combination. The focus of our genetic lab, Project 3, was to use PCR(Polymerase Chain Reactions) strategies to observe and study our own genetic variations and see if the match the Hardy-Weinberg equilibrium values. PCR is a popular method and the one we are using because of Its simple, quick, and efficient techniques. It copies whatever specific DNA strand is targeted and replicates it billions of times over, giving someone a lot to work with. We used this technique to study two specific loci, LCT and TAS2R38. LCT is located on chromosome 2 and encodes the enzyme lactase, which allows someone to process dairy product hence the name lactose intolerance. It is split into two separate alleles, C(recessive) or T(dominant) at SNP(-13,910). TAS2R38 is located on chromosome 7 and encodes the protein that allows someone to taste the bitterness of a PTC tasting strip. It splits into two alleles as well, T(dominant) and t(recessive). PTC tasting has useful results, but we will be using it only as practice. Using it is a very popular lab procedure because it is one of the most common alleles in human populations and has been studied so much already, giving it consistency and resources to consult. My team predicted that both loci are in Hardy-Weinberg equilibrium. Materials and MethodsUniversal Required Materials (All labs)- Ice – Waste bin – Microtube racks- Latex gloves – Micropipettes – Water bathsWet Lab I MaterialsPart IPart IIPart III-  PTC Paper- Control Paper- Collection swab- DNA Extraction Solutions- Heat blocks (set at 98o)- Vortex Mixer- 0.2 ml PCR tubes (25?l  PCR Master Mix)- Microcentrifuge- ThermocyclersWet Lab II MaterialsPart IPart IIPart III- PCR reaction tubes- Sterile distilled water- Restriction enzyme cocktails- .5 ml microtubules- Microcentrifuge- Original PCR reaction tubes- Digested PCR DNA- 10x Blue juice- Tube of DNA size ladder- Fotodyne minigel apparatus – Fotodyne UV Illuminator/ Camera- Agarose- Top loading balance- 125 Erlenmeyer flask- 1X TBE electrophoresis buffer- Graduated Cylinders- Microwave- Hot Hands- Ethidium bromide solution- NoneWet Lab I: Part I : TastingAfter obtaining an anonymous number, record it and prepare your PTC and Control tasting strips. Taste the PTC strip first. If you taste nothing, write down “Non Taster”. If it tastes very bitter, write down “Taster”. If you taste slight bitterness, write down “Partial Taster”. Record this information for later.Part II : DNA ExtractionAfter obtaining a DNA extraction solution, write your anonymous number on it. Before swabbing your cheeks with a collection swab rinse your mouth thoroughly. Swab about 20 times, and then press and rotate the swab into the DNA extraction solution tube to mix as much DNA into it. Shut the tube and place it into the vortex mixer for 10 seconds before placing it into the 65oC water bath for a minute. Next put it back into the vortex for 15 more seconds before incubating it for 2 minutes in a 98oC heat block. Last, place it into the vortex for 15 more seconds, allow it to cool naturally and then place it into ice.Part III : PCR Amplification | LCT and TAS2R38 Obtain two 0.2 ml PCR Master Mix tubes and avoid contamination. Label the tubes with your anonymous number and an L, T, to organize which primer mix is added to it. Next, obtain the tubes of primer mixes and pipet 20 ?l of each mixes into your corresponding PCR tubes and gently mix them. Then, pipette 5 ?l of your DNA extract from part II into your PCR tubes before putting them into a mini-centrifuge for 5 seconds. They should then be placed into the thermocycler for the following conditions in this order; 5 minutes at 95oC, 30 seconds at 95oC (40 cycles), 30 seconds at 55oC (40 cycles), 30 seconds at 72oC (40 cycles), 5 minutes at 72oC.Wet Lab II:Part I : Create the PCR Digest Obtain your finished PCR tubes and place them into ice once you allow them to completely thaw. For each enzyme digest that you will do, label a 0.5 microtubule with your anonymous number and an L or T depending on which PCR product that will be digested.Microtube(L or T)PCR DNASterile H2ORestriction Enzyme CocktailIncubation (water bath) Temp.L Tube5 ?l “L” PCR DNA5 ?l10 ?l “B” cocktail65oCT Tube5 ?l “T” PCR DNA5 ?l10 ?l “F” cocktail37oCCentrifuge the microtubes and place them in their indicated water bath for at least 60 minutes.Part II : PCR ElectrophoresisEach group will need to create two gels. Obtain a 30 ml of a 1.6% agarose solution and empty it into a 125 ml Erlenmeyer flask along with 30 ml of 1X TBE buffer and swirl to mix it. Cover the top of the Erlenmeyer flask with a weigh boat and microwave it for 45 seconds. Check to see if the solution is now clear, if it is not then place it back into the microwave for an additional 15-20 seconds. Once it has cooled to a safe warm temperature, have your instructor add ethidium bromide to it and swirl it. While still warm pour it into the gel tray with the comb in place and remove any bubbles as you let it cool. Once it has solidified, remove the comb and the gates to expose the edges and place it into the electrophoresis chamber, matching the marked color on the gel tray to the electrical node color. Lastly add 1X TBE buffer to the chamber so it is covered but not overflowing.      B. Find your PCR tube labeled P, add 6 ?l of 10X Blue Juice and pipette it up and down tomix them. Load your gel with the DNA size marker (M) (10 ?l) and each of your groupmembers P samples (20 ?l).Well #12345678Sample:emptyDNA size markerP1P2P3P4P5emptyPlace the lid on the chamber, connect the nodes (red to red / black to black), and run the gel for 60 minutes on High. Once completed, take the gel out and take a photo of it using the Fotodyne station.      C.  After removing the digested DNA from the water bath, add 3 ?l of 10X Blue Juice. Obtainyour undigested PCR tubes and add 6 ?l of Blue Juice and mix it well. Then, load the geltray following the tables below.Locus: L – Primer Sequence: 5’GTTGAATGCTCATACGACCATG3’Well #12345678DNASample:Dna Size MarkerUncutP1P2P3P4UncutemptyLocus: T – Primer Sequence: 5’AACTGGCAGATTAAAGATCTCAATTTAT3’Well #12345678DNASample:Dna Size MarkerUncutP1P2P3P4UncutemptyPlace the gels into the electrophoresis chamber for 60 minutes on high setting and once complete, take it to the fotodyne to photograph.Dry Lab Calculations: Hardy- Weinberg Equilibrium Once the gels are finished running through the electrophoresis chamber and photographed, the allele and genotypic frequencies were calculated using the Hardy-Weinberg equilibrium equations. We were able to use the equilibrium equation rather than the original model because the Hardy-Weinberg states that the population will remain constant if it is in equilibrium. This allowed us to use the two equations provided below.In this equation, p is equal to the frequency of your recessive allele while q is equal to the frequency of your dominant allele. Together they should add up to one, hence the name equilibrium.Freq(p) + Fre(q) = 1 This second equations, while similar to the first, includes the frequency of the heterozygous allele, and gives you the frequency of your genotypes instead of allele.Freq(p) + 2Freq(p)*Freq(q) + Freq(q) = 1 The chi squared (goodness of fit) equation is an equation that compares the group data to the class data to determine the accuracy and if the requirements were met. Xc2=(observed – expected)2expectedResults: Another objective of project 3 was to examine and study both the LCT and PCT gel DNA images. Compared to other results, our gels were decently clear and easy to read without any difficult decisions. Each shaded in line is a DNA fragment and can mean one of three things for an individual regarding their alleles. One shaded in line at 303 bp designates that the individual’s alleles for the test are recessive and homozygous (tt). Two shaded in line at 65 and 238 bp means that they are dominant and homozygous (TT). In order to be heterozygous the pattern needs to contain three DNA fragments (Tt). After being provided class values, we were able to calculate the frequencies of each genotype. The table below displays all the frequencies of each genotype which their respective locus. Locus Genotype Number of Individuals Frequency Lactose Homozygous Recessive (tt) 59     .1 Heterozygous (Tt) 261    .44 Homozygous Dominant(TT) 272    .46  Total – 592TAS2R38 Homozygous Recessive (tt) 184   0.29 Heterozygous (Tt) 316  0.497 Homozygous Dominant(TT) 134   0.21  Total – 636The table below displays all the frequencies of each allele which their respective locus.Locus FrequencyLactose p = CC = .32 q = TT = .68 TAS2R38 p = tt = .54 q = TT = .46 The table below displays all the values calculated from the chi squared formula.Locus NameFormula StepRecessiveHeterozygousDominantobserved59261272Lactoseexpected///deviated///final///observed184316134TAS2R38expected///deviated///final///Discussion: The main objective of this project was to analyze our DNA results swabbed from our cheeks. In order to do so we needed to use methods such polymerase chain reaction which allowed us to create many copies of our DNA to observe. Meanwhile for the mathematical portion, our objective was to understand how to compare results using the Hardy-Weinberg model. Our hypothesis of both loci, LTC and PTC, being in Hardy-Weinberg equilibrium was supported by both loci. The values we received during the HWE calculations on page 7 show that our numbers agree with the equilibrium on both loci. Unfortunately my results won’t be as accurate as it should as I wasn’t able to complete the chi squared equations and compare the P value to see if its large enough to make a difference.References: Knisely, K. (2014). A student handbook for writing in biology (4th ed.). Sunderland: Sinauer.Leicht, B. G. (2017). Foundations of Biology 1411 (Sixth ed.). Iowa City, IA: University Of Iowa.PgEd – Personal Genetics Education Project. (n.d.). Retrieved December 07, 2017, from https://pged.org/Wooding, S, (2006). Phenylthiocarbamide: A 75-Year Adventure in Genetics and Natural Selection. Salt Lake City: Utah.